cfx384 real time system c1000 thermal cycler (Bio-Rad)
Bio-Rad is a verified supplier 
Bio-Rad manufactures this product 
99
Structured Review
Bio-Rad
cfx384 real time system c1000 thermal cycler
Cfx384 Real Time System C1000 Thermal Cycler, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 496 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cfx384+real+time+system+c1000+thermal+cycler/C1000+Touch+Firmware+Update/pmc13033549-100-40-46
Average 99 stars, based on 496 article reviews
Cfx384 Real Time System C1000 Thermal Cycler, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 496 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cfx384+real+time+system+c1000+thermal+cycler/C1000+Touch+Firmware+Update/pmc13033549-100-40-46
Average 99 stars, based on 496 article reviews
cfx384 real time system c1000 thermal cycler - by Bioz Stars,
2026-11
99/100 stars
Images
Related Articles
Isolation:Article Title: MCL1 modulates mTORC1 signaling to promote bioenergetics and tumorigenesis. Article Snippet: BMitochondrial OCR of hearts isolated from (A) and immediately sliced, placed in Agilent Seahorse XF24 Islet Capture Microplate and measured by Seahorse XF24 metabolic Analyzer. (n = 4 mice per group). .. Total RNA was isolated from cells using NucleoSpin RNA Plus kit (Macherey-Nagel). cDNA Synthesis was performed using with the iScript reverse transcription kit (Bio-Rad). qPCR was carried out using the SsoFast Eva Green Supermix (Bio-Rad), a Article Title: MCL1 modulates mTORC1 signaling to promote bioenergetics and tumorigenesis Article Snippet: Cells were treated with inhibitors ABT-737 (Selleck Chem), ABBV-467 (MedChemExpress), UMI-77 (Selleck Chem), Rapamycin (Sigma-Aldrich) and L-Leucine (Sigma-Aldrich). .. Total RNA was isolated from cells using NucleoSpin RNA Plus kit (Macherey-Nagel). cDNA Synthesis was performed using with the iScript reverse transcription kit (Bio-Rad). qPCR was carried out using the SsoFast Eva Green Supermix (Bio-Rad), a cDNA Synthesis:Article Title: MCL1 modulates mTORC1 signaling to promote bioenergetics and tumorigenesis. Article Snippet: BMitochondrial OCR of hearts isolated from (A) and immediately sliced, placed in Agilent Seahorse XF24 Islet Capture Microplate and measured by Seahorse XF24 metabolic Analyzer. (n = 4 mice per group). .. Total RNA was isolated from cells using NucleoSpin RNA Plus kit (Macherey-Nagel). cDNA Synthesis was performed using with the iScript reverse transcription kit (Bio-Rad). qPCR was carried out using the SsoFast Eva Green Supermix (Bio-Rad), a Article Title: MCL1 modulates mTORC1 signaling to promote bioenergetics and tumorigenesis Article Snippet: Cells were treated with inhibitors ABT-737 (Selleck Chem), ABBV-467 (MedChemExpress), UMI-77 (Selleck Chem), Rapamycin (Sigma-Aldrich) and L-Leucine (Sigma-Aldrich). .. Total RNA was isolated from cells using NucleoSpin RNA Plus kit (Macherey-Nagel). cDNA Synthesis was performed using with the iScript reverse transcription kit (Bio-Rad). qPCR was carried out using the SsoFast Eva Green Supermix (Bio-Rad), a Reverse Transcription:Article Title: MCL1 modulates mTORC1 signaling to promote bioenergetics and tumorigenesis. Article Snippet: BMitochondrial OCR of hearts isolated from (A) and immediately sliced, placed in Agilent Seahorse XF24 Islet Capture Microplate and measured by Seahorse XF24 metabolic Analyzer. (n = 4 mice per group). .. Total RNA was isolated from cells using NucleoSpin RNA Plus kit (Macherey-Nagel). cDNA Synthesis was performed using with the iScript reverse transcription kit (Bio-Rad). qPCR was carried out using the SsoFast Eva Green Supermix (Bio-Rad), a Article Title: MCL1 modulates mTORC1 signaling to promote bioenergetics and tumorigenesis Article Snippet: Cells were treated with inhibitors ABT-737 (Selleck Chem), ABBV-467 (MedChemExpress), UMI-77 (Selleck Chem), Rapamycin (Sigma-Aldrich) and L-Leucine (Sigma-Aldrich). .. Total RNA was isolated from cells using NucleoSpin RNA Plus kit (Macherey-Nagel). cDNA Synthesis was performed using with the iScript reverse transcription kit (Bio-Rad). qPCR was carried out using the SsoFast Eva Green Supermix (Bio-Rad), a Real-time Polymerase Chain Reaction:Article Title: MCL1 modulates mTORC1 signaling to promote bioenergetics and tumorigenesis. Article Snippet: BMitochondrial OCR of hearts isolated from (A) and immediately sliced, placed in Agilent Seahorse XF24 Islet Capture Microplate and measured by Seahorse XF24 metabolic Analyzer. (n = 4 mice per group). .. Total RNA was isolated from cells using NucleoSpin RNA Plus kit (Macherey-Nagel). cDNA Synthesis was performed using with the iScript reverse transcription kit (Bio-Rad). qPCR was carried out using the SsoFast Eva Green Supermix (Bio-Rad), a Article Title: A key role of polyamine metabolism in adipose tissue homeostasis that regulates obesity. Article Snippet: Immunoprecipitation was performed by incubating the sheared chromatin with the magna ChIP protein A/G magnetic beads and the antibody either against H3K27Ac (Millipore 17-683), H3K9Ac (Millipore 17-658) or IgG control antibody overnight at 4 ◦C. .. Histone acetylation of Pparg2 promoter was assessed by qPCR using the following primers: F 5′TGTGTGGGTCACTGGCGAGACA3′; R 5′TGGCTGGCACTGTCCTGAC TGA3′ and the SsoFast Eva Green Supermix (Bio-Rad, Munich, Germany), a Article Title: Impedance-based phenotypic profiling of metabotropic glutamate receptor ligand responses in SCA1 human iPSC-derived neuronal cultures. Article Snippet: 4 μl of 1:40 diluted cDNA was mixed with 6 μl of the primer mix in a qPCR plate (4titude, cat#4ti-0382). .. The qPCR plate was centrifuged and sealed before starting the qPCR program on the Article Title: Supporting Information Cellular and molecular processes are differently influenced in primary neural cells by slight changes in the physico-chemical properties of multicore magnetic nanoparticles Article Snippet: - Primers and mastermix: 1 μL of primer mix (5 μM of each primer) + 5 uL Sso Fast EvaGreen Supermix (Biorad, CN 172-5204) which includes Sso7d-fusion DNA Polymerase, dNTPs and the rest of reagents needed to perform the qPCR. .. The rest of reactions were set up robotically, with an Eppendorf pipetting robot (epMotion 5075). qPCR reactions were performed in a Article Title: MCL1 modulates mTORC1 signaling to promote bioenergetics and tumorigenesis Article Snippet: Cells were treated with inhibitors ABT-737 (Selleck Chem), ABBV-467 (MedChemExpress), UMI-77 (Selleck Chem), Rapamycin (Sigma-Aldrich) and L-Leucine (Sigma-Aldrich). .. Total RNA was isolated from cells using NucleoSpin RNA Plus kit (Macherey-Nagel). cDNA Synthesis was performed using with the iScript reverse transcription kit (Bio-Rad). qPCR was carried out using the SsoFast Eva Green Supermix (Bio-Rad), a Software:Article Title: MCL1 modulates mTORC1 signaling to promote bioenergetics and tumorigenesis. Article Snippet: BMitochondrial OCR of hearts isolated from (A) and immediately sliced, placed in Agilent Seahorse XF24 Islet Capture Microplate and measured by Seahorse XF24 metabolic Analyzer. (n = 4 mice per group). .. Total RNA was isolated from cells using NucleoSpin RNA Plus kit (Macherey-Nagel). cDNA Synthesis was performed using with the iScript reverse transcription kit (Bio-Rad). qPCR was carried out using the SsoFast Eva Green Supermix (Bio-Rad), a Article Title: A key role of polyamine metabolism in adipose tissue homeostasis that regulates obesity. Article Snippet: Immunoprecipitation was performed by incubating the sheared chromatin with the magna ChIP protein A/G magnetic beads and the antibody either against H3K27Ac (Millipore 17-683), H3K9Ac (Millipore 17-658) or IgG control antibody overnight at 4 ◦C. .. Histone acetylation of Pparg2 promoter was assessed by qPCR using the following primers: F 5′TGTGTGGGTCACTGGCGAGACA3′; R 5′TGGCTGGCACTGTCCTGAC TGA3′ and the SsoFast Eva Green Supermix (Bio-Rad, Munich, Germany), a Article Title: MCL1 modulates mTORC1 signaling to promote bioenergetics and tumorigenesis Article Snippet: Cells were treated with inhibitors ABT-737 (Selleck Chem), ABBV-467 (MedChemExpress), UMI-77 (Selleck Chem), Rapamycin (Sigma-Aldrich) and L-Leucine (Sigma-Aldrich). .. Total RNA was isolated from cells using NucleoSpin RNA Plus kit (Macherey-Nagel). cDNA Synthesis was performed using with the iScript reverse transcription kit (Bio-Rad). qPCR was carried out using the SsoFast Eva Green Supermix (Bio-Rad), a other:Article Title: ACOD1 regulates microglial arginine metabolism and inflammatory responses Article Snippet: Total RNA was extracted from cells or tissues using the Nucleospin RNA isolation kit (Macherey-Nagel), according to manufacturer’s instructions. Article Title: ACOD1 regulates microglial arginine metabolism and inflammatory responses Article Snippet: Total RNA was extracted from cells or tissues using the Nucleospin RNA isolation kit (Macherey-Nagel), according to manufacturer’s instructions. Article Title: A key role of polyamine metabolism in adipose tissue homeostasis that regulates obesity. Article Snippet: Band intensity was quantified with the Fiji/ImageJ software [63]. Polymerase Chain Reaction:Article Title: Supporting Information Cellular and molecular processes are differently influenced in primary neural cells by slight changes in the physico-chemical properties of multicore magnetic nanoparticles Article Snippet: - Primers and mastermix: 1 μL of primer mix (5 μM of each primer) + 5 uL Sso Fast EvaGreen Supermix (Biorad, CN 172-5204) which includes Sso7d-fusion DNA Polymerase, dNTPs and the rest of reagents needed to perform the qPCR. .. The rest of reactions were set up robotically, with an Eppendorf pipetting robot (epMotion 5075). qPCR reactions were performed in a |